Advertisement

Blood flow in the anterior humeral circumflex artery reflects synovial inflammation of the shoulder joint in rotator cuff tears

Open AccessPublished:May 06, 2022DOI:https://doi.org/10.1016/j.jseint.2022.04.006

      Background

      An association has been reported between rotator cuff tear and inflammation. We hypothesized that blood flow in the anterior humeral circumflex artery would reflect synovial inflammation in the shoulder. This study aimed to clarify the association of blood flow in the anterior humeral circumflex artery with synovial inflammation and shoulder pain in patients with rotator cuff tears.

      Methods

      In this prospective, cross-sectional study, tissue samples from the synovium in the rotator interval were obtained from 33 patients undergoing arthroscopic rotator cuff repair. Reverse transcription-polymerase chain reaction and real-time polymerase chain reaction were performed to determine the messenger RNA expression of inflammatory mediators, growth factors, and matrix metalloproteinases. Additional tissue samples were fixed for histologic evaluation. Before surgery, we measured the peak systolic velocity in the anterior humeral circumflex artery using pulse Doppler ultrasonography.

      Results

      The peak systolic velocity in the anterior humeral circumflex artery was positively correlated with the messenger RNA expression of interleukin 1β, interleukin 8, and matrix metalloproteinase 3 genes (r = 0.49, P = .004; r = 0.55, P = .001; and r = 0.39, P = .026, respectively), as well as histologic synovitis scores (r = 0.48, P = .005). Additionally, it was significantly higher in patients with resting pain than in those without resting pain (P = .048).

      Conclusion

      The peak systolic velocity in the anterior humeral circumflex artery is associated with the severity of synovial inflammation. Our results suggest that assessing the peak systolic velocity in the anterior humeral circumflex artery is useful for evaluating the severity of synovial inflammation.

      Level of evidence

      Keywords

      Rotator cuff tears (RCTs) are common disorders that cause shoulder pain. Ultrasonography (US) and magnetic resonance imaging (MRI) have high accuracy for detecting RCTs
      • Fotiadou A.N.
      • Vlychou M.
      • Papadopoulos P.
      • Karataglis D.S.
      • Palladas P.
      • Fezoulidis I.V.
      Ultrasonography of symptomatic rotator cuff tears compared with MR imaging and surgery.
      ; however, the RCT size reportedly does not correlate with shoulder pain.
      • Dunn W.R.
      • Kuhn J.E.
      • Sanders R.
      • An Q.
      • Baumgarten K.M.
      • Bishop J.Y.
      • et al.
      Symptoms of pain do not correlate with rotator cuff tear severity: a cross-sectional study of 393 patients with a symptomatic atraumatic full-thickness rotator cuff tear.
      A noninvasive imaging modality for assessing the degree of inflammation has not yet been established.
      Nighttime pain is a typical symptom in patients with rotator cuff pathology.
      • Codman E.
      The shoulder: Rupture of the supraspinatus tendon and other lesions in or about the subacromial bursa.
      Although several studies have reported the factors associated with nighttime pain in shoulder disorders, including sleeping position,
      • Kempf B.
      • Kongsted A.
      Association between the side of unilateral shoulder pain and preferred sleeping position: a cross-sectional study of 83 Danish patients.
      skin temperature,
      • Miyakoshi N.
      • Itoi E.
      • Sato K.
      • Suzuki K.
      • Matsuura H.
      Skin temperature of the shoulder: circadian rhythms in normal and pathologic shoulders.
      abnormal neovessels,
      • Okuno Y.
      • Oguro S.
      • Iwamoto W.
      • Miyamoto T.
      • Ikegami H.
      • Matsumura N.
      Short-term results of transcatheter arterial embolization for abnormal neovessels in patients with adhesive capsulitis: a pilot study.
      and melatonin,
      • Ha E.
      • Lho Y.M.
      • Seo H.J.
      • Cho C.H.
      Melatonin plays a role as a mediator of nocturnal pain in patients with shoulder disorders.
      its pathology remains unclear. Nighttime pain reportedly decreases after transcatheter arterial embolization of abnormal neovessels
      • Okuno Y.
      • Oguro S.
      • Iwamoto W.
      • Miyamoto T.
      • Ikegami H.
      • Matsumura N.
      Short-term results of transcatheter arterial embolization for abnormal neovessels in patients with adhesive capsulitis: a pilot study.
      and steroid injections.
      • Gialanella B.
      • Prometti P.
      Effects of corticosteroids injection in rotator cuff tears.
      ,
      • Juel N.G.
      • Oland G.
      • Kvalheim S.
      • Løve T.
      • Ekeberg O.M.
      Adhesive capsulitis: one sonographic-guided injection of 20 mg triamcinolon into the rotator interval.
      Based on these findings, we hypothesized that the inflammation associated with angiogenesis is one of the causes of nighttime pain. Power Doppler US can be used to evaluate synovial inflammation by detecting vascularity, especially in patients with rheumatoid arthritis.
      • Porta F.
      • Radunovic G.
      • Vlad V.
      • Micu M.C.
      • Nestorova R.
      • Petranova T.
      • et al.
      The role of Doppler ultrasound in rheumatic diseases.
      ,
      • Walther M.
      • Harms H.
      • Krenn V.
      • Radke S.
      • Faehndrich T.P.
      • Gohlke F.
      Correlation of power Doppler sonography with vascularity of the synovial tissue of the knee joint in patients with osteoarthritis and rheumatoid arthritis.
      However, the synovitis in RCTs is reportedly of low grade,
      • Stahnke K.
      • Morawietz L.
      • Moroder P.
      • Scheibel M.
      Synovitis as a concomitant disease in shoulder pathologies.
      and power Doppler US was not suitable for detecting low-grade inflammation.
      • Koski J.M.
      • Saarakkala S.
      • Helle M.
      • Hakulinen U.
      • Heikkinen J.O.
      • Hermunen H.
      Power Doppler ultrasonography and synovitis: correlating ultrasound imaging with histopathological findings and evaluating the performance of ultrasound equipments.
      ,
      • Oo W.M.
      • Linklater J.M.
      • Bennell K.L.
      • Yu S.
      • Fu K.
      • Wang X.
      • et al.
      Superb microvascular imaging in Low-grade inflammation of knee osteoarthritis compared with power Doppler: clinical, radiographic and MRI relationship.
      Therefore, we focused on the blood flow in the anterior humeral circumflex artery (AHCA), whose branch supplies the anterior part of the lateral aspect of the capsule,
      • Andary J.L.
      • Petersen S.A.
      The vascular anatomy of the glenohumeral capsule and ligaments: an anatomic study.
      and the rotator interval (RI).
      • Põldoja E.
      • Rahu M.
      • Kask K.
      • Bulecza T.
      • Weyers I.
      • Kolts I.
      Blood supply of the superior glenohumeral ligament: a gross anatomical and histological study.
      A previous study reported that the peak systolic velocity (PSV) in the AHCA measured using pulse Doppler US was increased in RCTs with nighttime pain
      • Terabayashi N.
      • Watanabe T.
      • Matsumoto K.
      • Takigami I.
      • Ito Y.
      • Fukuta M.
      • et al.
      Increased blood flow in the anterior humeral circumflex artery correlates with night pain in patients with rotator cuff tear.
      ; however, the molecular, biological, and histopathological evaluations were not demonstrated. Thus, the association between blood flow in the AHCA and synovial inflammation remains unclear.
      This study had a 2-fold purpose: (1) to clarify the association between PSV in the AHCA and synovial inflammation and (2) to clarify the association between PSV in the AHCA and shoulder pain.

      Materials and methods

      Ethical approval and study design

      This study was approved by the relevant institutional review board, and informed consent was obtained from all patients. This was a prospective, cross-sectional study.

      Patients

      This study included patients with RCTs who underwent arthroscopic rotator cuff repair between August 2019 and February 2021 (Fig. 1). Of the 51 patients who underwent arthroscopic rotator cuff repair, 18 were excluded for one of the following reasons: rheumatoid arthritis or other collagen diseases; previous surgery or manipulation of the affected shoulders; history of corticosteroid, hyaluronic acid, or nonsteroidal anti-inflammatory drug use, including oral forms or injections, within 4 weeks before operation; patients in whom the AHCA could not be confirmed using US before surgery; and complete tear of the long head of biceps tendon because the ascending branch of the AHCA runs alongside the long head of biceps tendon.
      • Hufeland M.
      • Hamed G.
      • Kubo H.
      • Pilge H.
      • Krauspe R.
      • Filler T.
      • et al.
      Blood supply in the bicipital groove: a histological analysis.
      Furthermore, to harvest the synovial sample at a consistent point, cases in which the RI retracted more medial than the glenoid border due to the complete tear of subscapularis were also excluded. Finally, 33 patients were included.
      Figure thumbnail gr1
      Figure 1Flow diagram of patient selection. AHCA, anterior humeral circumflex artery; LHB, long head of biceps tendon; RI, rotator interval.

      Clinical evaluation

      We defined nighttime pain as an aching pain that disturbs sleep. We questioned the patients about the presence of nighttime pain or resting pain before surgery. The RCT size was evaluated intraoperatively using the classification introduced by Cofield.
      • Cofield R.H.
      Subscapular muscle transposition for repair of chronic rotator cuff tears.

      Ultrasonographic examination

      Ultrasonographic examinations were performed independently by 3 experienced sonographers with extensive experience in musculoskeletal US, using a LOGIQ E9 scanner (GE Healthcare, Bensalem, PA, USA) with a 6- to 15-MHz linear transducer. Blood flow in the AHCA was assessed using pulse Doppler US, as previously described.
      • Terabayashi N.
      • Watanabe T.
      • Matsumoto K.
      • Takigami I.
      • Ito Y.
      • Fukuta M.
      • et al.
      Increased blood flow in the anterior humeral circumflex artery correlates with night pain in patients with rotator cuff tear.
      First, the color Doppler mode was used to identify the AHCA (Fig. 2, A). Pulse Doppler mode was used to measure the PSV in the AHCA on a longitudinal scan (Fig. 2, B). After waveforms appeared similar to each other, PSV was measured at the tallest waveform. On the nonoperative side, the presence or absence of RCT and PSV in the AHCA was also evaluated.
      Figure thumbnail gr2
      Figure 2Method of measuring the peak systolic velocity (PSV) in the anterior humeral circumflex artery (AHCA). (A) Short-axis color Doppler ultrasound (US) image of the bicipital groove. The ascending branch of the AHCA (arrow) is confirmed. (B) Pulse Doppler US image measuring the PSV (arrowhead). The arrow points to the long-axis color Doppler US image of the ascending branch of the AHCA.
      In a pilot study, intrarater and inter-rater reliabilities were assessed by examining 5 healthy volunteers.

      Arthroscopic synovitis score

      The degree of glenohumeral synovitis was graded as previously described.
      • Davis D.E.
      • Maltenfort M.
      • Abboud J.A.
      • Getz C.
      Classifying glenohumeral synovitis: a novel intraoperative scoring system.
      Retrospectively, videos of the arthroscopic surgery were independently evaluated by 2 shoulder surgeons in a blinded fashion to assess interobserver reliability. Glenohumeral synovitis was graded based on the following 4 characteristics: color of capsule, villous projections, capillaries, and axillary recess. The score of each objective criterion was summed, and the total synovitis score ranged from 0 to 6.

      Tissue samples

      During surgery, the synovial tissue samples harvested from the RI were immediately frozen in liquid nitrogen at −80°C for polymerase chain reaction (PCR) analysis. The remaining samples were fixed with 4% paraformaldehyde for histologic analysis.

      Reverse transcription PCR and real-time PCR

      Total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). Reverse transcription PCR was performed using a high-capacity complementary DNA reverse transcription kit that included an RNase inhibitor (Thermo Fisher Scientific, Waltham, MA, USA). Real-time PCR for the vascular endothelial growth factor, nerve growth factor, interleukins (IL1B, IL6, and IL8), tumor necrosis factor-α, and matrix metalloproteinases 3 and 13 (MMP3 and MMP13) was performed using TB Green Premix Ex Taq II (Takara Bio, Shiga, Japan). The expression level of each gene was normalized to that of glyceraldehyde-3-phosphate using the comparative CT method. Primers other than IL8 were obtained from past reports,
      • Klatte-Schulz F.
      • Minkwitz S.
      • Schmock A.
      • Bormann N.
      • Kurtoglu A.
      • Tsitsilonis S.
      • et al.
      Different Achilles tendon pathologies show distinct histological and molecular characteristics.
      ,
      • Shindle M.K.
      • Chen C.C.
      • Robertson C.
      • DiTullio A.E.
      • Paulus M.C.
      • Clinton C.M.
      • et al.
      Full-thickness supraspinatus tears are associated with more synovial inflammation and tissue degeneration than partial-thickness tears.
      ,
      • Takano S.
      • Uchida K.
      • Inoue G.
      • Miyagi M.
      • Aikawa J.
      • Iwase D.
      • et al.
      Nerve growth factor regulation and production by macrophages in osteoarthritic synovium.
      and IL8 primers were obtained from the PrimerBank database
      • Spandidos A.
      • Wang X.
      • Wang H.
      • Seed B.
      PrimerBank: A resource of human and mouse PCR primer pairs for gene expression detection and quantification.
      (PrimerBank ID: 10834978a2). The PCR primer sequences are listed in Table I.
      Table IList of primer sequences.
      GeneSequence (5′-3′)Reference
      VEGFF: ATCAGTTCGAGGAAAGGGAAA

      R: CTGCGGATCTTGTACAAACAAA
      Shindle et al, 2011
      • Shindle M.K.
      • Chen C.C.
      • Robertson C.
      • DiTullio A.E.
      • Paulus M.C.
      • Clinton C.M.
      • et al.
      Full-thickness supraspinatus tears are associated with more synovial inflammation and tissue degeneration than partial-thickness tears.
      NGFF: CCCATCCCATCTTCCACAGG

      R: GGTGGTCTTATCCCCAACCC
      Takano et al, 2017
      • Takano S.
      • Uchida K.
      • Inoue G.
      • Miyagi M.
      • Aikawa J.
      • Iwase D.
      • et al.
      Nerve growth factor regulation and production by macrophages in osteoarthritic synovium.
      IL1BF: GTACCTGTCCTGCGTGTTGA

      R: GGGAACTGGGCAGACTCAAA
      Takano et al, 2017
      • Takano S.
      • Uchida K.
      • Inoue G.
      • Miyagi M.
      • Aikawa J.
      • Iwase D.
      • et al.
      Nerve growth factor regulation and production by macrophages in osteoarthritic synovium.
      IL6F: TGCAGAAAAAGGCAAAGAATC

      R: TAAAGCTGCGCAGAATGAGAT
      Shindle et al, 2011
      • Shindle M.K.
      • Chen C.C.
      • Robertson C.
      • DiTullio A.E.
      • Paulus M.C.
      • Clinton C.M.
      • et al.
      Full-thickness supraspinatus tears are associated with more synovial inflammation and tissue degeneration than partial-thickness tears.
      IL8F: ACTGAGAGTGATTGAGAGTGGAC

      R: AACCCTCTGCACCCAGTTTTC
      Spandidos et al, 2010
      • Spandidos A.
      • Wang X.
      • Wang H.
      • Seed B.
      PrimerBank: A resource of human and mouse PCR primer pairs for gene expression detection and quantification.


      PrimerBank ID 10834978a2
      TNFAF: CTTCTGCCTGCTGCACTTTG

      R: GTCACTCGGGGTTCGAGAAG
      Takano et al, 2017
      • Takano S.
      • Uchida K.
      • Inoue G.
      • Miyagi M.
      • Aikawa J.
      • Iwase D.
      • et al.
      Nerve growth factor regulation and production by macrophages in osteoarthritic synovium.
      MMP3F: TGGGCCAGGGATTAATGGAG

      R: GGCCAATTTCATGAGCAGCA
      Klatte-Schulz et al, 2018
      • Klatte-Schulz F.
      • Minkwitz S.
      • Schmock A.
      • Bormann N.
      • Kurtoglu A.
      • Tsitsilonis S.
      • et al.
      Different Achilles tendon pathologies show distinct histological and molecular characteristics.
      MMP13F: CTTTTGGAATTAAGGAGCATGG

      R: TTGTCCAGGTTTCATCATCATC
      Shindle et al, 2011
      • Shindle M.K.
      • Chen C.C.
      • Robertson C.
      • DiTullio A.E.
      • Paulus M.C.
      • Clinton C.M.
      • et al.
      Full-thickness supraspinatus tears are associated with more synovial inflammation and tissue degeneration than partial-thickness tears.
      GAPDHF: GAGTCAACGGATTTGGTCGTATT

      R: GACAAGCTTCCCGTTCTCAGCCT
      Shindle et al, 2011
      • Shindle M.K.
      • Chen C.C.
      • Robertson C.
      • DiTullio A.E.
      • Paulus M.C.
      • Clinton C.M.
      • et al.
      Full-thickness supraspinatus tears are associated with more synovial inflammation and tissue degeneration than partial-thickness tears.
      VEGF, vascular endothelial growth factor; F, forward; R, reverse; NGF, nerve growth factor; IL, interleukin; TNFA, tumor necrosis factor-α; MMP, matrix metalloproteinase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

      Histopathological assessment

      Tissue samples were fixed with 4% paraformaldehyde for 24 hours and embedded in paraffin for histologic analysis. The samples were cut into 5-μm-thick sections. Hematoxylin and eosin staining was performed following the standard protocol. The degree of synovitis was graded using the synovitis score, as described by Krenn et al.
      • Krenn V.
      • Morawietz L.
      • Burmester G.R.
      • Kinne R.W.
      • Mueller-Ladner U.
      • Muller B.
      • et al.
      Synovitis score: Discrimination between chronic low-grade and high-grade synovitis.
      ,
      • Krenn V.
      • Morawietz L.
      • Häupl T.
      • Neidel J.
      • Petersen I.
      • König A.
      Grading of chronic synovitis--a histopathological grading system for molecular and diagnostic pathology.
      The synovitis score comprises 3 morphological parameters (enlargement of the synovial lining cell layer, the density of the resident cells, and inflammatory infiltrate). Three parameters were scored from 0 to 3 and summed to establish a total synovitis score ranging from 0 to 9. Each slide was independently evaluated in a blinded fashion by 2 trained and experienced orthopedic surgeons to assess interobserver reliability.

      Immunohistochemistry

      Immunohistochemistry was performed to determine IL-8 and MMP-3 expression. Sections were pretreated and subsequently incubated with primary antibodies against CXCL8/IL8 (27095-1-AP; Proteintech North America, Chicago, IL, USA; dilution 1:500) and MMP3 (ab52918; Abcam, Cambridge, UK; dilution 1:200) at 4°C overnight. After rinsing, the sections were incubated with an antirabbit secondary antibody containing horseradish peroxidase for 30 minutes (Dako North America, Inc., Carpinteria, CA, USA). Antibody binding was visualized using a diaminobenzidine substrate (Dako North America Inc., Carpinteria, CA, USA), and counterstaining was performed with hematoxylin.

      Statistical analysis

      This study sought to estimate the correlation coefficient with reliable accuracy. Therefore, the sample size was designed to include 33 patients, assuming a Spearman's correlation coefficient of 0.6 and a 95% confidence interval (CI) width of <0.5.
      • Bonett D.G.
      • Wright T.A.
      Sample size requirements for estimating Pearson, Kendall and Spearman correlations.
      Patient characteristics were summarized as the median and interquartile range for continuous variables and as numbers and percentages for categorical variables. The inter-rater reliability for measuring PSV among the 3 examiners was confirmed using the intraclass correlation coefficient (ICC) of the 2-way random-effects model. The intrarater reliability for measuring PSV was confirmed by using the ICC of the 1-way random-effects model. To evaluate the validity of the arthroscopic and histologic synovitis scores, the ICC was calculated for values measured by 2 surgeons.
      The PSV in the AHCA was compared between the operated and nonoperated sides using the Wilcoxon signed-rank sum test according to the presence or absence of RCT. To confirm the association between the PSV in the AHCA and synovial inflammation, Spearman's correlation coefficient was calculated. The Mann-Whitney U test was used to compare the difference in the PSV and the histologic synovitis scores between groups with and without resting pain, with and without nighttime pain, or traumatic and atraumatic RCTs.
      The receiver operating characteristic curve and the best cutoff point were calculated to estimate the diagnostic performance of the PSV in the AHCA for resting pain. The cutoff point was calculated according to the Youden index, and its sensitivity and specificity were also determined. The Kruskal-Wallis test was performed to compare the PSV in the AHCA between RCT sizes. If the Kruskal-Wallis test result was statistically significant, a Steel-Dwass test was planned for paired comparisons. The association between nighttime pain and resting pain was confirmed using Fisher’s exact test. A 2-sided P value of <0.05 was considered statistically significant, and all statistical analyses were performed using the R software program, version 4.1.1 (www.r-project.org).

      Results

      Clinical characteristics

      This study included 33 patients comprising 22 men and 11 women, with a median age of 62 (58-71) years. The clinical characteristics of the patients are shown in Table II.
      Table IIClinical characteristics of patients.
      Characteristicn = 33
      Age
      Data are presented as the median (interquartile range).
      (yr)
      62 (58-71)
      Sex (male), n (%)22 (66.7)
      Duration of symptoms, n (mo)
      Data are presented as the median (interquartile range).
      6 (3-12)
      Preoperative ROM (deg)
      Data are presented as the median (interquartile range).
       Active FE100 (80-160)
       Passive FE150 (110-160)
       Active ER40 (30-60)
       Passive ER40 (40-60)
      Tear size, n (%)
       Small7 (21.2)
       Medium11 (33.3)
       Large8 (24.2)
       Massive7 (21.2)
      Involved tendons, n (%)
       SSP4 (12.1)
       SSP + ISP3 (9.1)
       SSP + SSC3 (9.1)
       SSP + ISP + SSC23 (69.7)
      Traumatic onset, n (%)27 (81.8)
      Nighttime pain, n (%)18 (54.5)
      Resting pain, n (%)11 (33.3)
      PSV in the AHCA
      Data are presented as the median (interquartile range).
      (cm/s)
      22.3 (18.6-28.3)
      ROM, range of motion; FE, forward elevation; ER, external rotation; SSP, supraspinatus; ISP, infraspinatus; SSC, subscapularis; PSV, peak systolic velocity; AHCA, anterior humeral circumflex artery.
      Data are presented as the median (interquartile range).

      Intrarater and inter-rater reliability for measuring the PSV in the AHCA

      The intrarater reliabilities for measuring the PSV in the AHCA were 0.996 (95% CI, 0.981-0.999), 0.989 (95% CI, 0.945-0.998), and 0.993 (95% CI, 0.965-0.999) for the 3 examiners. The inter-rater reliability for measuring the PSV in the AHCA was very good (0.985; 95% CI, 0.935-0.998).

      Inter-rater reliability for arthroscopic and histologic synovitis score

      The ICC for the arthroscopic synovitis score was 0.756 (95% CI, 0.564-0.871), whereas it was 0.590 (95% CI, 0.318-0.773) for the histologic synovitis score.

      Comparison of the PSV in the AHCA between the operated and nonoperated sides

      Of the 33 patients, 4 were excluded for 1 of the following reasons: previous surgery of the nonoperated shoulder and unconfirmed AHCA of the nonoperated shoulder using US before surgery. PSV was significantly higher on the surgical side than on the nonsurgical side, regardless of the presence or absence of RCT on the nonoperated side (Table III).
      Table IIIComparison of PSV in the AHCA between the operated and nonoperated sides.
      Presence of RCT on the nonoperated sidenPSV in the AHCA on the operated side (cm/s)PSV in the AHCA on the nonoperated side (cm/s)P value
      With RCT1220.1 (18.9-26.6)17.7 (13.2-18.4).005
      P < .01.
      Without RCT1722.5 (18.6-32.0)14.5 (12.4-21.2).017
      P < .05.
      PSV, peak systolic velocity; AHCA, anterior humeral circumflex artery; RCT, rotator cuff tear.
      P < .05.
      P < .01.

      Association between the PSV in the AHCA and synovial inflammation

      The PSV in the AHCA significantly and positively correlated with the mRNA expression levels of IL1B, IL8, and MMP3 (IL1B: r = 0.49, P = .004; IL8: r = 0.55, P = .001; MMP3: r = 0.39, P = .026; Table IV). The PSV in the AHCA significantly and positively correlated with the arthroscopic synovitis score (r = 0.40, P = .022; Fig. 3, A). In patients with low PSV, the color of the capsule was pale, and a few villous projections were observed (Fig. 3, B). In patients with high PSV, the color of the capsule was red, and extensive villous projections were observed (Fig. 3, C).
      Table IVCorrelation between the PSV in the AHCA and gene expression.
      GeneCorrelation coefficient95% CIP value
      VEGF−0.21−0.51, 0.15.252
      NGF0.03−0.32, 0.37.882
      IL1B0.490.18, 0.71.004
      P < .01.
      IL60.31−0.03, 0.59.077
      IL80.550.26, 0.75.001
      P < .01.
      TNFA−0.06−0.4, 0.29.73
      MMP30.390.05, 0.65.026
      P < .05.
      MMP130.32−0.03, 0.6.072
      PSV, peak systolic velocity; AHCA, anterior humeral circumflex artery; CI, confidence interval; VEGF, vascular endothelial growth factor; NGF, nerve growth factor; IL, interleukin; TNFA, tumor necrosis factor-α; MMP, matrix metalloproteinase.
      P < .05.
      P < .01.
      Figure thumbnail gr3
      Figure 3Arthroscopic score of glenohumeral synovitis. (A) Peak systolic velocity (PSV) in the anterior humeral circumflex artery (AHCA) significantly and positively correlated with the glenohumeral synovitis score. R is Spearman’s rho. ∗P < .05. (B) Arthroscopic image of a patient with a low PSV in the AHCA. The color of the capsule is pale, and a few villous projections are observed. (C) Arthroscopic image of a patient with a high PSV in the AHCA. The color of the capsule is red, and extensive villous projections are observed.
      The PSV in the AHCA also significantly and positively correlated with the histologic synovitis score (r = 0.48, P = .005) (Fig. 4, A). More enlargement of the synovial lining cell layer and inflammatory infiltration were observed in patients with high PSV than in those with low PSV (Fig. 4, B, C).
      Figure thumbnail gr4
      Figure 4Histologic evaluation of synovitis. Scale bars = 50 μm; hematoxylin and eosin stain. (A) The peak systolic velocity (PSV) in the anterior humeral circumflex artery (AHCA) significantly and positively correlated with the histologic synovitis score. R is Spearman’s rho. ∗∗P < .01. (B) Light microscopy images of the synovium in a patient with a low PSV demonstrate no enlargement of the synovial lining cell layer and only a slight inflammatory infiltration. (C) Light microscopy images of the synovium from a patient with a high PSV demonstrate enlargement of the synovial lining cell layer and inflammatory infiltration.
      Immunohistochemical staining of the synovium demonstrated increased staining for IL8 and MMP3 in samples from patients with high PSV (Fig. 5). IL8 was expressed around the vessels, whereas MMP3 was expressed in the synovial lining cells.
      Figure thumbnail gr5
      Figure 5Histologic and immunohistochemical images of the synovium from patients with a low peak systolic velocity (PSV) and a high PSV. Immunohistochemical staining of the synovium demonstrates increased staining for interleukin 8 (IL8) and matrix metalloproteinase 3 (MMP3) in a sample obtained from patients with high PSV. IL8 is expressed around vessels, and MMP3 is expressed in the synovial lining cells. Scale bars = 50 μm. HE, hematoxylin and eosin stain.

      Association of shoulder pain with the PSV in the AHCA and with synovial inflammation

      No significant difference in the PSV in the AHCA was observed between patients with and without nighttime pain (P = .708; Table V). The PSV in the AHCA was significantly higher among patients with resting pain than that among those without resting pain (P = .048; Table VI).
      Table VComparison of the PSV in the AHCA and histologic synovitis score between patients with and without nighttime pain.
      Patients without nighttime pain (n = 15)Patients with nighttime pain (n = 18)P value
      PSV (cm/s)20.9 (18.9-27.0)26.2 (15.9-31.1).708
      Histologic synovitis score3.0 (2.0-3.0)3.5 (3.0-4.8).040
      P < .05.
      PSV, peak systolic velocity; AHCA, anterior humeral circumflex artery.
      P < .05.
      Table VIComparison of the PSV in the AHCA and histologic synovitis score between patients with and without resting pain.
      Patients without resting pain (n = 22)Patients with resting pain (n = 11)P value
      PSV (cm/s)20.8 (18.4-26.4)27.5 (20.2-33.3).048
      P < .05.
      Histologic synovitis score3.0 (2.3-3.0)4.0 (3.0-5.5).023
      P < .05.
      PSV, peak systolic velocity; AHCA, anterior humeral circumflex artery.
      P < .05.
      In the receiver operating characteristic analysis, the diagnostic accuracy of the PSV in the AHCA for resting pain yielded an area under the curve of 0.715 (95% CI, 0.519-0.910), with 0.636 sensitivity and 0.773 specificity. The best cutoff value of the PSV in the AHCA was 26.7 cm/s. No significant association was observed between the PSV in the AHCA and RCT size (P = .58). Similarly, no significant difference in the PSV in the AHCA was observed between traumatic and atraumatic RCTs (P = .48).
      The histologic synovitis score was significantly higher among patients with nighttime pain than that among those without nighttime pain (P = .040; Table V). The histologic synovitis score was significantly higher among patients with resting pain than that among those without resting pain (P = .023; Table VI). No significant difference in gene expression was observed between patients with and without nighttime pain or between those with and without resting pain.
      In total, 61.1% (11/18) of patients with nighttime pain experienced resting pain, whereas no patient (0/15) experienced resting pain among those without nighttime pain. In those with nighttime pain, the PSV in the AHCA was significantly higher in patients with resting pain than that in those without resting pain (P = .02).

      Discussion

      The results of this study suggest that the PSV in the AHCA was associated with synovial inflammation in the glenohumeral joint. The PSV in the AHCA positively correlated with IL1B, IL8, and MMP3 mRNA expression of the synovial samples as well as arthroscopic and histologic synovitis scores in RCTs. The PSV in the AHCA was higher in patients with resting pain than that in those without resting pain.
      Several studies have suggested that synovial inflammation is observed in cases of RCT. A previous histologic study reported synovitis of the RI in patients with RCTs.
      • Abrams G.D.
      • Luria A.
      • Carr R.A.
      • Rhodes C.
      • Robinson W.H.
      • Sokolove J.
      Association of synovial inflammation and inflammatory mediators with glenohumeral rotator cuff pathology.
      ,
      • Stahnke K.
      • Morawietz L.
      • Moroder P.
      • Scheibel M.
      Synovitis as a concomitant disease in shoulder pathologies.
      Gotoh et al reported that IL1B mRNA expression in RI samples was increased in patients with perforating RCTs.
      • Gotoh M.
      • Hamada K.
      • Yamakawa H.
      • Yanagisawa K.
      • Nakamura M.
      • Yamazaki H.
      • et al.
      Interleukin-1-induced glenohumeral synovitis and shoulder pain in rotator cuff diseases.
      Noh et al reported that the levels of IL1B and IL8 were elevated in synovial fluids among patients with RCT.
      • Noh K.C.
      • Park S.H.
      • Yang C.J.
      • Lee G.W.
      • Kim M.K.
      • Kang Y.H.
      Involvement of synovial matrix degradation and angiogenesis in oxidative stress-exposed degenerative rotator cuff tears with osteoarthritis.
      IL8 is a member of the CXC chemokine family that is induced under inflammatory conditions and is a potent angiogenic factor.
      • Koch A.E.
      • Polverini P.J.
      • Kunkel S.L.
      • Harlow L.A.
      • DiPietro L.A.
      • Elner V.M.
      • et al.
      Interleukin-8 as a macrophage-derived mediator of angiogenesis.
      ,
      • Rosenkilde M.M.
      • Schwartz T.W.
      The chemokine system -- a major regulator of angiogenesis in health and disease.
      Abrams et al reported that MMP3 gene expression correlated with the degree of synovitis.
      • Abrams G.D.
      • Luria A.
      • Carr R.A.
      • Rhodes C.
      • Robinson W.H.
      • Sokolove J.
      Association of synovial inflammation and inflammatory mediators with glenohumeral rotator cuff pathology.
      These previous reports indicated that synovial inflammation along with angiogenesis is associated with the pathophysiology of RCTs. In our study, the PSV in the AHCA positively correlated with IL1B, IL8, and MMP3 mRNA expression and synovitis. Therefore, we suggest that the PSV in the AHCA is a good indicator of synovial inflammation severity.
      Clinical studies have reported an association between the blood flow around the shoulder and shoulder pain using a dynamic MRI. Tamai et al assessed the coefficient of enhancement in the glenohumeral synovium using dynamic MRI, and clinical improvement was associated with a decrease in the coefficient of enhancement.
      • Tamai K.
      • Mashitori H.
      • Ohno W.
      • Hamada J.
      • Sakai H.
      • Saotome K.
      Synovial response to intraarticular injections of hyaluronate in frozen shoulder: a quantitative assessment with dynamic magnetic resonance imaging.
      Sasanuma et al reported that increased abnormal blood flow (burning sign) in the RI was observed in 53% of patients with symptomatic RCTs, and burning sign was associated with shoulder pain.
      • Sasanuma H.
      • Sugimoto H.
      • Iijima Y.
      • Kanaya Y.
      • Saito T.
      • Takeshita K.
      Blood flow evaluation by dynamic magnetic resonance imaging of symptomatic rotator cuff tears and frozen shoulders.
      These reports suggested that angiogenesis is involved in the pathology of shoulder disorders. Therefore, we suggest that evaluating blood flow around the shoulder is important for understanding the pathophysiological conditions of RCTs.
      Pulse Doppler US has many advantages over dynamic MRI. Pulse Doppler US is noninvasive and can be evaluated in real time; therefore, it is suitable for follow-ups. Furthermore, results are expressed numerically, and the intrarater and inter-rater reliabilities were high in this study; thus, it allows objective evaluation of synovial inflammation. Accordingly, we believe that measuring blood flow in the AHCA using pulse Doppler US is useful for evaluating synovial inflammation in the shoulder. As a conservative treatment for RCTs, intra-articular injection of steroids and hyaluronic acid is used to suppress inflammation.
      • Shibata Y.
      • Midorikawa K.
      • Emoto G.
      • Naito M.
      Clinical evaluation of sodium hyaluronate for the treatment of patients with rotator cuff tear.
      Objective methods for assessing the degree of inflammation have not yet been established; therefore, we estimated the effect of the injection by observing the changes in pain. By measuring blood flow in the AHCA, we can probably objectively evaluate whether inflammation was controlled by the injection. Therefore, further longitudinal studies are needed to investigate the association between the changes in clinical symptoms and the PSV in the AHCA.
      In this study, the PSV in the AHCA and the histologic synovitis score were significantly higher in RCT patients with resting pain than those in patients without resting pain. Our results indicate that synovial inflammation is associated with resting pain; however, the expression of inflammatory cytokines was not significantly different between those with and without resting pain. Among previous studies using enzyme-linked immunosorbent assay, Shih et al reported that IL1B levels in the shoulder synovial fluid were significantly and positively correlated with shoulder pain,
      • Shih C.A.
      • Wu K.C.
      • Shao C.J.
      • Chern T.C.
      • Su W.R.
      • Wu P.T.
      • et al.
      Synovial fluid biomarkers: association with chronic rotator cuff tear severity and pain.
      and Okamura et al reported that IL8 levels in the shoulder joint fluid were associated with resting pain.
      • Okamura K.
      • Kobayashi T.
      • Yamamoto A.
      • Shitara H.
      • Osawa T.
      • Ichinose T.
      • et al.
      Shoulder pain and intra-articular interleukin-8 levels in patients with rotator cuff tears.
      Contrarily, Gotoh et al reported that the IL1B mRNA expression levels in the RI were inversely correlated with the degree of pain.
      • Gotoh M.
      • Hamada K.
      • Yamakawa H.
      • Yanagisawa K.
      • Nakamura M.
      • Yamazaki H.
      • et al.
      Interleukin-1-induced glenohumeral synovitis and shoulder pain in rotator cuff diseases.
      Therefore, the association between shoulder pain and inflammatory cytokines is controversial. In this study, various phases of RCTs were included, particularly shoulder stiffness. A previous study reported that IL1B levels in the joint fluids were significantly higher in RCTs with stiffness than those in cases without stiffness.
      • Ko J.Y.
      • Wang F.S.
      • Huang H.Y.
      • Wang C.J.
      • Tseng S.L.
      • Hsu C.
      Increased IL-1beta expression and myofibroblast recruitment in subacromial bursa is associated with rotator cuff lesions with shoulder stiffness.
      This study included various disease states of RCTs such as shoulder stiffness, arthritis, and impingement; therefore, further investigation wherein study participants are classified based on disease states is needed to clarify the association between inflammatory cytokines and shoulder pain.
      Regarding nighttime pain, no significant difference in the PSV in the AHCA was observed between patients with and without nighttime pain. However, the histologic synovitis score was significantly higher in patients with nighttime pain, and more patients with nighttime pain also experienced resting pain than those without nighttime pain. Consequently, we suggest that nighttime pain is multifactorial and that synovial inflammation is one of its causes. In this study, the effect of sleeping position and turning over on pain could not be completely eliminated; thus, a more detailed analysis is needed to investigate the pathophysiological mechanisms of nighttime pain.
      This study had some limitations. First, a selection bias in the study population was present as we only studied patients who underwent surgery. Most patients received conservative treatment before surgery; therefore, patients with RCTs immediately after injury were not included. Second, this was a cross-sectional study, and changes in the clinical symptoms and PSV in the AHCA were not investigated. Therefore, further longitudinal studies are needed to investigate the changes in clinical symptoms and the PSV in the AHCA after conservative treatment.

      Conclusion

      This study indicates that the PSV in the AHCA is associated with the severity of synovial inflammation in RCTs. The PSV in the AHCA was significantly higher in patients with resting pain than that in those without resting pain. Our results suggest that the PSV in the AHCA is useful for evaluating synovial inflammation in patients with RCTs.

      Disclaimers:

      Funding: This work was supported by JSPS KAKENHI, Japan (grant number: JP19K18459).
      Conflicts of interest: The authors, their immediate families, and any research foundation with which they are affiliated have not received any financial payments or other benefits from any commercial entity related to the subject of this article.

      Acknowledgments

      The authors would like to thank Tomotake Hayashi, Ayae Takada, and Juri Nakayama for their assistance with the collection of ultrasonographic data, as well as their useful comments.

      References

        • Abrams G.D.
        • Luria A.
        • Carr R.A.
        • Rhodes C.
        • Robinson W.H.
        • Sokolove J.
        Association of synovial inflammation and inflammatory mediators with glenohumeral rotator cuff pathology.
        J Shoulder Elbow Surg. 2016; 25: 989-997https://doi.org/10.1016/j.jse.2015.10.011
        • Andary J.L.
        • Petersen S.A.
        The vascular anatomy of the glenohumeral capsule and ligaments: an anatomic study.
        J Bone Joint Surg Am. 2002; 84: 2258-2265https://doi.org/10.2106/00004623-200212000-00020
        • Bonett D.G.
        • Wright T.A.
        Sample size requirements for estimating Pearson, Kendall and Spearman correlations.
        Psychometrika. 2000; 65: 23-28
        • Codman E.
        The shoulder: Rupture of the supraspinatus tendon and other lesions in or about the subacromial bursa.
        R. E. Kreiger, 1934: 151-152
        • Cofield R.H.
        Subscapular muscle transposition for repair of chronic rotator cuff tears.
        Surg Gynecol Obstet. 1982; 154: 667-672
        • Davis D.E.
        • Maltenfort M.
        • Abboud J.A.
        • Getz C.
        Classifying glenohumeral synovitis: a novel intraoperative scoring system.
        J Shoulder Elbow Surg. 2017; 26: 2047-2053https://doi.org/10.1016/j.jse.2017.06.003
        • Dunn W.R.
        • Kuhn J.E.
        • Sanders R.
        • An Q.
        • Baumgarten K.M.
        • Bishop J.Y.
        • et al.
        Symptoms of pain do not correlate with rotator cuff tear severity: a cross-sectional study of 393 patients with a symptomatic atraumatic full-thickness rotator cuff tear.
        J Bone Joint Surg Am. 2014; 96: 793-800https://doi.org/10.2106/jbjs.L.01304
        • Fotiadou A.N.
        • Vlychou M.
        • Papadopoulos P.
        • Karataglis D.S.
        • Palladas P.
        • Fezoulidis I.V.
        Ultrasonography of symptomatic rotator cuff tears compared with MR imaging and surgery.
        Eur J Radiol. 2008; 68: 174-179https://doi.org/10.1016/j.ejrad.2007.11.002
        • Gialanella B.
        • Prometti P.
        Effects of corticosteroids injection in rotator cuff tears.
        Pain Med. 2011; 12: 1559-1565https://doi.org/10.1111/j.1526-4637.2011.01238.x
        • Gotoh M.
        • Hamada K.
        • Yamakawa H.
        • Yanagisawa K.
        • Nakamura M.
        • Yamazaki H.
        • et al.
        Interleukin-1-induced glenohumeral synovitis and shoulder pain in rotator cuff diseases.
        J Orthop Res. 2002; 20: 1365-1371https://doi.org/10.1016/s0736-0266(02)00063-3
        • Ha E.
        • Lho Y.M.
        • Seo H.J.
        • Cho C.H.
        Melatonin plays a role as a mediator of nocturnal pain in patients with shoulder disorders.
        J Bone Joint Surg Am. 2014; 96: e108https://doi.org/10.2106/jbjs.M.01011
        • Hufeland M.
        • Hamed G.
        • Kubo H.
        • Pilge H.
        • Krauspe R.
        • Filler T.
        • et al.
        Blood supply in the bicipital groove: a histological analysis.
        Orthop Rev (Pavia). 2019; 11: 8106https://doi.org/10.4081/or.2019.8106
        • Juel N.G.
        • Oland G.
        • Kvalheim S.
        • Løve T.
        • Ekeberg O.M.
        Adhesive capsulitis: one sonographic-guided injection of 20 mg triamcinolon into the rotator interval.
        Rheumatol Int. 2013; 33: 1547-1553https://doi.org/10.1007/s00296-012-2503-4
        • Kempf B.
        • Kongsted A.
        Association between the side of unilateral shoulder pain and preferred sleeping position: a cross-sectional study of 83 Danish patients.
        J Manipulative Physiol Ther. 2012; 35: 407-412https://doi.org/10.1016/j.jmpt.2012.04.015
        • Klatte-Schulz F.
        • Minkwitz S.
        • Schmock A.
        • Bormann N.
        • Kurtoglu A.
        • Tsitsilonis S.
        • et al.
        Different Achilles tendon pathologies show distinct histological and molecular characteristics.
        Int J Mol Sci. 2018; 19: 404https://doi.org/10.3390/ijms19020404
        • Ko J.Y.
        • Wang F.S.
        • Huang H.Y.
        • Wang C.J.
        • Tseng S.L.
        • Hsu C.
        Increased IL-1beta expression and myofibroblast recruitment in subacromial bursa is associated with rotator cuff lesions with shoulder stiffness.
        J Orthop Res. 2008; 26: 1090-1097https://doi.org/10.1002/jor.20631
        • Koch A.E.
        • Polverini P.J.
        • Kunkel S.L.
        • Harlow L.A.
        • DiPietro L.A.
        • Elner V.M.
        • et al.
        Interleukin-8 as a macrophage-derived mediator of angiogenesis.
        Science. 1992; 258: 1798-1801
        • Koski J.M.
        • Saarakkala S.
        • Helle M.
        • Hakulinen U.
        • Heikkinen J.O.
        • Hermunen H.
        Power Doppler ultrasonography and synovitis: correlating ultrasound imaging with histopathological findings and evaluating the performance of ultrasound equipments.
        Ann Rheum Dis. 2006; 65: 1590-1595https://doi.org/10.1136/ard.2005.051235
        • Krenn V.
        • Morawietz L.
        • Burmester G.R.
        • Kinne R.W.
        • Mueller-Ladner U.
        • Muller B.
        • et al.
        Synovitis score: Discrimination between chronic low-grade and high-grade synovitis.
        Histopathology. 2006; 49: 358-364https://doi.org/10.1111/j.1365-2559.2006.02508.x
        • Krenn V.
        • Morawietz L.
        • Häupl T.
        • Neidel J.
        • Petersen I.
        • König A.
        Grading of chronic synovitis--a histopathological grading system for molecular and diagnostic pathology.
        Pathol Res Pract. 2002; 198: 317-325https://doi.org/10.1078/0344-0338-5710261
        • Miyakoshi N.
        • Itoi E.
        • Sato K.
        • Suzuki K.
        • Matsuura H.
        Skin temperature of the shoulder: circadian rhythms in normal and pathologic shoulders.
        J Shoulder Elbow Surg. 1998; 7: 625-628
        • Noh K.C.
        • Park S.H.
        • Yang C.J.
        • Lee G.W.
        • Kim M.K.
        • Kang Y.H.
        Involvement of synovial matrix degradation and angiogenesis in oxidative stress-exposed degenerative rotator cuff tears with osteoarthritis.
        J Shoulder Elbow Surg. 2018; 27: 141-150https://doi.org/10.1016/j.jse.2017.08.007
        • Okamura K.
        • Kobayashi T.
        • Yamamoto A.
        • Shitara H.
        • Osawa T.
        • Ichinose T.
        • et al.
        Shoulder pain and intra-articular interleukin-8 levels in patients with rotator cuff tears.
        Int J Rheum Dis. 2017; 20: 177-181https://doi.org/10.1111/1756-185x.12581
        • Okuno Y.
        • Oguro S.
        • Iwamoto W.
        • Miyamoto T.
        • Ikegami H.
        • Matsumura N.
        Short-term results of transcatheter arterial embolization for abnormal neovessels in patients with adhesive capsulitis: a pilot study.
        J Shoulder Elbow Surg. 2014; 23: e199-206https://doi.org/10.1016/j.jse.2013.12.014
        • Oo W.M.
        • Linklater J.M.
        • Bennell K.L.
        • Yu S.
        • Fu K.
        • Wang X.
        • et al.
        Superb microvascular imaging in Low-grade inflammation of knee osteoarthritis compared with power Doppler: clinical, radiographic and MRI relationship.
        Ultrasound Med Biol. 2020; 46: 566-574https://doi.org/10.1016/j.ultrasmedbio.2019.11.017
        • Põldoja E.
        • Rahu M.
        • Kask K.
        • Bulecza T.
        • Weyers I.
        • Kolts I.
        Blood supply of the superior glenohumeral ligament: a gross anatomical and histological study.
        Austin J Anat. 2016; 3: 1048
        • Porta F.
        • Radunovic G.
        • Vlad V.
        • Micu M.C.
        • Nestorova R.
        • Petranova T.
        • et al.
        The role of Doppler ultrasound in rheumatic diseases.
        Rheumatology (Oxford). 2012; 51: 976-982https://doi.org/10.1093/rheumatology/ker433
        • Rosenkilde M.M.
        • Schwartz T.W.
        The chemokine system -- a major regulator of angiogenesis in health and disease.
        APMIS. 2004; 112: 481-495https://doi.org/10.1111/j.1600-0463.2004.apm11207-0808.x
        • Sasanuma H.
        • Sugimoto H.
        • Iijima Y.
        • Kanaya Y.
        • Saito T.
        • Takeshita K.
        Blood flow evaluation by dynamic magnetic resonance imaging of symptomatic rotator cuff tears and frozen shoulders.
        J Shoulder Elbow Surg. 2018; 27: e372-e379https://doi.org/10.1016/j.jse.2018.05.042
        • Shibata Y.
        • Midorikawa K.
        • Emoto G.
        • Naito M.
        Clinical evaluation of sodium hyaluronate for the treatment of patients with rotator cuff tear.
        J Shoulder Elbow Surg. 2001; 10: 209-216
        • Shih C.A.
        • Wu K.C.
        • Shao C.J.
        • Chern T.C.
        • Su W.R.
        • Wu P.T.
        • et al.
        Synovial fluid biomarkers: association with chronic rotator cuff tear severity and pain.
        J Shoulder Elbow Surg. 2018; 27: 545-552https://doi.org/10.1016/j.jse.2017.09.020
        • Shindle M.K.
        • Chen C.C.
        • Robertson C.
        • DiTullio A.E.
        • Paulus M.C.
        • Clinton C.M.
        • et al.
        Full-thickness supraspinatus tears are associated with more synovial inflammation and tissue degeneration than partial-thickness tears.
        J Shoulder Elbow Surg. 2011; 20: 917-927https://doi.org/10.1016/j.jse.2011.02.015
        • Spandidos A.
        • Wang X.
        • Wang H.
        • Seed B.
        PrimerBank: A resource of human and mouse PCR primer pairs for gene expression detection and quantification.
        Nucleic Acids Res. 2010; 38: D792-799https://doi.org/10.1093/nar/gkp1005
        • Stahnke K.
        • Morawietz L.
        • Moroder P.
        • Scheibel M.
        Synovitis as a concomitant disease in shoulder pathologies.
        Arch Orthop Trauma Surg. 2019; 139: 1111-1116https://doi.org/10.1007/s00402-019-03152-4
        • Takano S.
        • Uchida K.
        • Inoue G.
        • Miyagi M.
        • Aikawa J.
        • Iwase D.
        • et al.
        Nerve growth factor regulation and production by macrophages in osteoarthritic synovium.
        Clin Exp Immunol. 2017; 190: 235-243https://doi.org/10.1111/cei.13007
        • Tamai K.
        • Mashitori H.
        • Ohno W.
        • Hamada J.
        • Sakai H.
        • Saotome K.
        Synovial response to intraarticular injections of hyaluronate in frozen shoulder: a quantitative assessment with dynamic magnetic resonance imaging.
        J Orthop Sci. 2004; 9: 230-234https://doi.org/10.1007/s00776-004-0766-7
        • Terabayashi N.
        • Watanabe T.
        • Matsumoto K.
        • Takigami I.
        • Ito Y.
        • Fukuta M.
        • et al.
        Increased blood flow in the anterior humeral circumflex artery correlates with night pain in patients with rotator cuff tear.
        J Orthop Sci. 2014; 19: 744-749https://doi.org/10.1007/s00776-014-0604-5
        • Walther M.
        • Harms H.
        • Krenn V.
        • Radke S.
        • Faehndrich T.P.
        • Gohlke F.
        Correlation of power Doppler sonography with vascularity of the synovial tissue of the knee joint in patients with osteoarthritis and rheumatoid arthritis.
        Arthritis Rheum. 2001; 44: 331-338